Effect of metalloproteinase-2 on expression of tissue inhibitor of matrix metalloproteinase-4 in cutaneous wound healing in balb/c mice

Document Type: Original Article

Authors

1 Department of Oral and Maxillofacial Pathology, Dental School, Shahid Beheshti University of Medical Science, Tehran, Iran

2 Dental Research Center, Dental School, Shahid Beheshti University of Medical Science, Tehran ,Iran

3 Biochemistry department, Pasteur institute of Iran,Tehran, Iran.

10.22034/jbr.2020.223176.1020

Abstract

Introduction: Wound healing comprised serial phases. Though the insitu factors activate to rehabilitate properly immediately after wounding, it eventuate in scar frequently. Collagenases and their inhibitors have dramatic role in processes which prevents scaring.
Objective: We inject “TIMP-4” in cutaneous wound in BALB/C mice to block MMP-2 and search for consequence.
Methods: MMP-2 antibody was injected in dorsal skin of 6-8 weeks BALB/C mice at the level of scapula, on certain periods (4houres, 3 days, 7 days and 14 days after wounding)we collect tissue specimens from dorsal skin of mice using 3mm punch biopsy. We cloned CDNA of MMP-2 and TIMP-4 ,then investigate the expression of genes (using quantitative real time RT-PCR and IHC). The results were analyzed in Wilcoxon Signed Ranks Test, Kruskal-Wallis and Dunn (SPSS version PASW Statistics 18). 
.
Results: Four hours after wounding RNA copies and enzymes of MMP-2 increased with lower inflammation in treated samples, RNA copies and enzyme of TIMP-4 was almost similar in the first stage. Three days after injury RNA copies of MMP-2 and TIMP-4 increased and epithelial reattachment was lower in treated group. TIMP-4 enzymes and inflammation rised in third group, the number of RNA copies of TIMP-4 did not change, but the number of RNA copies of MMP-2 decreased in treated samples. Although forth treated group shows lower RNA copies of TIMP-4, the number of RNA copies of MMP-2 increased.
Conclusion: This study indicates that immunotherapy by MMP-2 antibody can lead to regeneration and scar reduction with lower TIMP-4 enzymes.

Graphical Abstract

Effect of metalloproteinase-2 on expression of tissue inhibitor of matrix metalloproteinase-4 in cutaneous wound healing in balb/c mice

Keywords


  1. Introduction

Wound is defined as a break in epithelial integrity of skin altering the structure and disrupting the function of the normal underlying tissue. Wound healing is a complex, dynamic and well-orchestrated series of events that results in restoration of the injured tissue [1]. Abnormal controlling mechanisms of wound healing can cause visible cutaneous scars [2,3] and non-healing ulcers. The process of wound healing and scarring greatly depends on epithelial-mesenchymal interactions [4,5]. Excessive collagen is deposited in hypertrophic scar formation. Regulation of collagen synthesis and deposition can directly control scar tissue formation [6,7]. Controlled degradation of the surrounding matrix is required for cell migration, granulation tissue formation, angiogenesis, and stromal remodeling [8]. Among all the known families of growth factors [9] and extracellular proteases involved in tissue remodeling [10], the matrix metalloproteinases (MMPs, matrixins) are a major and extensively-studied family [11]. The MMP family consists of 24 members expressed in various species. MMPs are zinc-dependent endopeptidases capable of cleaving extracellular matrix (ECM) components [12]. Tissue inhibitors of metalloproteinases (TIMPs) are local inhibitors of MMPs and thus control the MMP-induced breakdown of extracellular matrix. If over-expressed [13,14], they may lead to chronic inflammation and non-healing ulcers [15]. This process is mediated by indiscriminate degradation of matrix, cytokines, and other components present in wound environment ]16,17[. The TIMP family comprises four members, TIMP-1, -2, -3, and -4, that inhibit MMPs by binding to their active site in a 1:1 stoichiometric ratio[18]. TIMP-4 is the recently cloned TIMP [11]. It has been demonstrated that TIMP-4 can inhibit the breast cancer cells’ invasion potential under in vitro conditions and prevent growth and metastasis of tumors in nude mice under in vivo conditions [19]. It inhibits MMPs-2 and -7 somewhat better than MMPs-1,-3, and-9[11].It has been demonstrated that TIMP-4 protein is produced by stromal cells adjacent to the blood vessels in chronic wounds. However, the situation is different in normally healing wounds ]7,12[. In order to evolve factors intervening in ECM metabolism in mice according the role of MMP-2 and its inhibitor TIMP-4, we injected diluted MMP-2 antibody to mice. By cloning the cDNA of MMP-2 and TIMP-4, we examined the expression of MMP-2 and TIMP-4 enzymes using a quantitative real-time PCR. This method enabled us to see any precious possible change in the amount of MMP-2 and subsequent alterations in level of TIMP-4 expression and process of wound healing. Our goal is to provide a first step toward remedies [13,15,20,21] eventuate in a better healing.  This project can lead to changes in outlook toward cutaneous wound healing, an important principle of human being.

 

  1. Materials and Methods

2.1.   Animals

6-8-weeks-old male BALB/C mice obtained from Pasteur Institute of Iran were used for all the experiments and maintained according to the institutional guidelines. The animals were maintained in cages with access to mouse chow and water ad libitum. All regarded to ethic code (1390.14). Regarding the 7th edition of Helsinki declaration in 2013 the experiment has been done under direct supervision of ethic committee and a considerable consultation with a doctor of veterinary medicine has been gained.

 

2.2. Dorsal skin manipulations

Animals were divided into four groups of 7 mice each. Dorsal skin of all mice was shaved at the level of scapula under general anesthesia.

One day later, anesthesia was induced using a special formula ]20[ and the mice were injured. Wounds were prepared on dorsal skin of the mice at level of scapula using 1 mm biopsy punch and microsurgery scissors. Two wounds were prepared at the same distances from the midline in each mouse, serving as case and control wounds. Diluted MMP-2 antibody (1:100, ab110186, Abcam, UK) was injected locally next to the injured skin in each mouse. After 4 hours, samples were taken from the first group using 3mm biopsy punch under general anesthesia. Animals were then sacrificed. This was done for the other groups at time points demonstrated in Table 1 (Module and procedure).

 

 

 

 

 

Table 1. Module and procedure of the experiment

Injection

Group 1

Group 2

Group 3

Group 4

At the time of injuring

4 hours after injuring

Sacrificed

3 days after injuring

 

Sacrificed

7 days after injuring

 

 

Sacrificed

14 days after injuring

 

 

 

Sacrificed

 

 

 

Table 2. PCR primers used in cDNA cloning, and quantitative real time PCR.

Gene

PCR primers

MMP2

Fw:5'AGTGGTCCGCGTAAAGTATGG 3'

Rv:5'CTCAAAGTTGTATGTGGTGGAGC3'

TIMP4

Fw:5'GAACTGTGGCTGCCAAATCAC 3'

Rv:5'TACCCATAGAGCTTCCGTTCC 3'

TBP

Fw: 5’GCGATTTGCTGCAGTCATCA3’

RV:5’GTTCTTCACTCTTGGCTCCTGTG3’

 

 

Table 3. Summary of digoxygenin-labeled sense and antisense ribo-probes used in real time PCR.

Gene

probe

Position of the sequense (base)

amplicon

MMP2

Sense

antisense

954-974

1073-1095

142

TIMP4

Sense

antisense

533-553

620-640

108

TBP

Sense

Antisense

763-782

841-863

101

                                                     

                                                     Figure 1. Histological staining of “Group 1”. H&E stained paraffin embedded sections (a: treated sample, b: control sample). MMP-2 immunoreactivity in paraffin sections (c: treated sample, d: control sample), TIMP-4 immunoreactivity in paraffin embedded sections (e: treated sample, f: control sample).

 

 

 

2.3. Antibody injection

Diluted MMP-2 antibody was injected locally next to the injured skin at time points demonstrated in Table 1.

 

2.4. RNA extraction

RNA was extracted from fresh dorsal skin using TRI reagent (CinnaGen, IRAN) according to the manufacturer’s instructions. RNA concentration was determined by measuring the absorbance at 260 nm and the quality of RNA was assessed by A260/A280 ratio.

 

 

 

2.5. Real time RT-PCR

Total RNA isolated from dorsal skin as described above was cleaned up using RNX-Plus solution (RN7713C, CinnaGen, Iran) according to the manufacturer’s protocol; 500 ng of total RNA was reverse transcribed using AccuPowerCycleScript RT PreMix (dN6) Kit (Bioneer, USA); cDNA template for each sample was prepared according to the manufacturer’s instructions. Gene-specific forward (1 µl) and reverse (1 µl) primers (Table 2) were added yielding total volume of 20 µl. In order to prevent PCR saturation, amplifications were performed at cycle numbers within the linear range previously determined for each gene. Table 3 shows the primer sequences and amplicon sizes for the analyzed genes. Genes were normalized with TBP.

 

 

 

 

Table 4. Statistical analysis

Test Statisticsd,e

 

mmp2.t.E - mmp2.c.E

mmp2.t.B - mmp2.c.B

mmp2.t.C - mmp2.c.C

timp4.t.E   - timp4.c.E

timp4.t.B  - timp4.c.B

timp.t.C     - timp4.c.C

connec.t    -     connec.c

epi.t              -             epi.c

infl.t             -            infl.c

type.t           -          type.c

 

Group 1

Z

P-value

-2.236a

0.025

0.000b

1.000

 

0.000b

1.000

-1.414a

0.157

0.000b

1.000

-1.414c

0.157

-2.000a

0.046

-2.236a

0.025

-2.460c

0.014

-1.732c

0.083

 

Group 2

Z

P-value

0.000a

1.000

0.000a

1.000

-1.000b

0.317

-.378c

0.705

0.000a

1.000

-1.000c

0.317

0.000a

1.000

-2.000c

0.046

-0.707c

0.480

-1.342b

0.180

 

Group 3

Z

P-value

-1.000a

.317

.000b

1.000

-1.342c

.180

 

-2.232a

0.026

0.000b

1.000

-1.890a

0.059

-1.000a

0.317

0.000b

1.000

 

-2.000a

0.046

-1.000a

0.317

 

 

Group 4

Z

P-value

-1.414a

0.157

-1.732a

0.083

0.000b

1.000

0.000b

1.000

-1.000c

0.317

-0.816c

0.414

0.000b

1.000

0.000b

1.000

0.000b

1.000

0.000b

1.000

 

                           

Wilcoxon Signed Ranks Test is used for intergroup analysis.

           Kruskal Wallis and Dunn Test are used for interagroup analysis

 

 

 

 
     

Figure 2. Histological features of “Group2”. H&E stained (a: treated sample, b: control sample). MMP-2 immunoreactivity (c: treated sample, d: control sample), TIMP-4 immunoreactivity (e: treated sample, f: control sample).


 

          

 

 

Figure 3. Histological features of “Group3”. H&E staining (a: treated sample, b: control sample). MMP-2 immunoreactivity (c: treated sample, d: control sample), TIMP-4 immunoreactivity (e: treated sample, f: control sample).

 

 

 

2.6. Immunohistochemistry

Immunohistochemistry was performed on sections serial to those used for real-time PCR. TIMP-4 antibody (SAB4502974, sigma, USA) was diluted 1:100 and MMP-2 (ab110186,abcam,UK), 1:100. The peroxidase-antiperoxidase technique was applied using diaminobenzidine or aminoethylcarbazole as a chromogenic substrate and Hematoxylin as counterstain, as described in detail. When needed, sections were pretreated with 10 mg/rnL trypsin. Untreated samples for TIMP-4 and MMP-2 were used as negative controls. Controls were performed with normal mouse immunoglobulins or with rabbit preimmune serum. Positive controls were specimens of breast cancer stained with MMP-2 and TIMP-4 antibodies.

The results were analyzed in Wilcoxon Signed Ranks Test, Kruskal_Wallis and Dunn (SPSS version PASW Statistics 18).

 

  1. Results

Real time RT-PCR showed increased of MMP-2 RNA level in the first, second and fourth treated groups and increased level in TIMP-4 RNA expression in the second treated group.

Using antibody of MMP-2 in treated models in four groups the regulation of MMP-2 and TIMP-4 enzymes and RNA copies was studied. As shown in Table 4 exogenous antibody of MMP-2 in four hours after wounding led to increased steady state levels of MMP-2 RNA in treated groups. The number of RNA copies of TIMP-4 was similar and low in treated cases and controls. Three days after wounding the study led to higher level of RNA copies of both genes in treated samples, a marked increase in RNA copies of MMP-2 was shown in third day after wounding (Table 4). Seven days after wounding the number of RNA copies of TIMP-4 was almost similar in both groups. The number of RNA copies of MMP-2 was lower in treated samples (Table 4). Fourteen days after wounding the RNA copies of TIMP-4 was almost similar in treated and control samples, but the study led to higher level of RNA copies of MMP-2 in all treated cases, but the exact number of copies could not be obtained (Table 4).

MMP-2 was higher in four hours after wounding but TIMP-4 was higher seven days after wounding.

The results were analyzed in Wilcoxon Signed Ranks Test, Kruskal_Wallis and Dunn .By immunohistochemistry, MMP-2 enzymes was produced higher four hours after wounding in treated group (p-value: 0/025). But the inflammation was lower in treated samples (p-value: 0/014). Connective tissue in control groups was granulation tissue but in treated cases reticular layers was shown (p-value: 0/046) There was not any other differences between treated and control cases. Three days after wounding more epithelial reattachment was shown in control ones (p-value: 0/046). No other differences were shown between them. Seven days after wounding more TIMP-4 enzymes were shown in treated cases (p-value: 0/026) but no difference in the level of MMP-2 enzymes was produced (p-value: 0/317). More inflammation was shown in treated ones. By IHC there was not any differences in treated and control cases after fourteen days after injury (p-value>0/05).

Immunohistochemistry detected higher level of TIMP-4 in epithelial layer and connective tissue of the third treated group (p-value<0/05). These enzymes were produced by epithelial cells and fibroblasts. MMP-2 enzyme in epithelial layers showed a higher level in the first treated group; whereas, MMP-2 enzymes in basal cell layer was higher in fourth treated group. Higher epithelial attachment and reattachment was shown in all treated groups except for the second (3 days) treated group. The first treated group showed greater degree of inflammation among the other treated groups. Chronic inflammatory cells were more prominent in the first treated group but in other treated groups acute inflammatory cells were more frequent than the others.

 

 

 

 
Figure 4. Histological features of “Group4”. H&E staining (a: treated sample, b: control sample). MMP-2 immunoreactivity (c: treated sample, d: control sample), TIMP-4 immunoreactivity (e: treated sample, f: control sample)

       

      

 

  1. Discussion and conclusion

Many studies have shown that matrix metalloproteinases play an important role in wound healing and scar formation ]6,7,22[. However, these enzymes degrade the degenerated collagen fibers and help wound healing [23], increased function of this family will lead to chronic wound ]7,24,25[. Recent studies mentioned that metalloproteinases are expressed in a controlled manner during cutaneous wound repair [26,27[. Tissue inhibitors of this family (TIMPs) regulate the (role of) MMPs [11]. Correlations between these two-family lead to normal wound healing [28,29]. Similar studies have been done with exogenous TGF-β3 for labioplasty ]8[. Immunotherapy with exogenous TGF- β3 lead to reduced scar formation in an incised and sutured mouth lip. Although both treatment with TGF- β3 and TIMP-4 eventuate in reduced scarring, the modules, samples, donor sites and suturing were not the same. 

We investigated the effect of exogenous MMP-2 antibody on endogenous MMP-2 and TIMP-4 role in cutaneous wound healing by counting the cells stained with MMP-2 and TIMP-4 antibodies. Also, real time RT-PCR was carried out to evaluate RNA expression ]30, 31[.

In early hours after wounding, decreased inflammation was noted in treated samples. However, the connective tissue of treated samples was similar to normal skin with normal reticular layers; but the controls show granulation tissue ]32[. It seems that blocking the MMP-2 enzymes in early hours led to diminished degradation of collagen fibers in treated samples. The level of MMP-2 increased as well. It seems that the inactive MMP-2 enzymes have been activated because of the presence of exogenous MMP-2 antibody. The injected antibodies during the first 4 hours did not have sufficient time to react with all the available enzymes. Additionally, activation of the previously inactive enzymes led to an increase in MMP-2 in ECM and its staining. Furthermore, it seems that cells in treated samples did not receive a signal indicating MMP-2 shortage in ECM. Thus, the expression of MMP-2 RNA in cells of treated samples did not increase. However, in controls, increased expression of MMP-2 RNA was observed ]31[.

It seems that during three days after wounding, tissues have reconstruct the shortage of mRNA of MMP-2 and inflammatory cells have been increased in tissue in treated samples.

Increasing level of TIMP-4 enzyme in seventh day after wounding in treated cases may be due to the recent memory of increased production of MMP-2 enzyme or may indicate ECM signaling for increasing the production of MMP-2 which leads to a subsequent increase in production of TIMP-4 ]33[. Also higher number of inflammatory cells in treated samples indicates a direct correlation between number of these cells and increased level of TIMP-4 enzyme. It seems that higher expression of this enzyme results in more inflammation ]33[.

At 14 days after wounding, concentrations of these two enzymes were the same in treated and control cases and therefore, all the understudy variables were similar in test and control samples. However, the PCR showed lower concentration of MMP-2 enzyme in treated cases ]30[.

TIMP-4 is a recognized tissue inhibitor of metalloproteinase family. In humans, it has only been detected in the heart and at low levels in kidneys, placenta, colon, testes and in stromal cells of chronic ulcers near blood vessels ]7, 12, 34[. On the contrary, in mice, TIMP-4 is expressed markedly in a broad range of tissues, including the skin, indicating its important role as a regulator of ECM turnover [16]. We investigated its expression in dermal wounds. We detected the production of TIMP-4 in control skin samples in mice. Our results suggest that in the process of dermal wound healing, TIMP-4 appears to be affected by exogenous MMP-2 antibody and variations of this enzyme. Our study indicates that exogenous antibody of MMP-2 (1:100) can lead to regeneration and scar reduction during cutaneous wound healing.

Future studies are recommended to evaluate the role of other members of MMPs family and their tissue inhibitors in cutaneous wound healing, since several MMPs are also likely to play a role during epithelial migration in skin repair

In conclusion, it seems that immunotherapy with MMP-2 antibody leads to a reduction in expression of MMP-2 in the wound area and affects the repair process. Because TIMPs may function in the tissue environment to neutralize proteinases, thereby preventing excessive and unwanted degradation, their inadequate production may lead to non-healing, chronic wounds.

 

Conflict of interest

The authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest, or non-financial interest in the subject matter or materials discussed in this manuscript.

 

Acknowledgement

All sources of funding is acknowledged at the end of the text. We declare the involvement of study sponsors, Dental Research Center of Shahid Beheshti university of medical sciences, and biochemistry department of Pasteur Institute of Iran, in the study design, collection, analysis and interpretation of data; the writing of the manuscript; the decision to submit the manuscript for publication. We should have a special thanks to Dr. Nariman Mosaffa, DVM and Phd in immunology who was consultor of the project.

We kindly give our gratitude to the sponsors of our experiment.

References
[1]        Broughton G 2nd, Janis JE, Attinger CE. The basic science of wound healing. Plast Reconstr Surg 2006 Jun; 117(7 Suppl):12S-34S.
[2]        Ferguson MWJ, O'Kane S. Scar–free healing: from embryonic mechanisms to adult therapeutic intervention. Royal society 2004; 359(1445).
[3]        Bellayr IH, Walters TJ, Li Y. Scarless wound healing. The journal of the American college of certifies wound specialists. 2010 June; 40-43.
[4]        Gurtner GC, Werner S, Barrandon Y, Longaker MT. Wound repair and regeneration 2008; 453:314-321.
[5]        Wells A, Nuschke A, Yates CC. Skin tissue repair: Matrix microenvironmental influences. Matrix Biology 2016; 49:25-36.
[6]        Schreml S, SzeimiesR, Prantl L, Landthaler M,  Babilas P. Wound healing in the 21st century. Journal of the American Academy of Dermatology 2010; 63(5):866-881.
[7]        Vaalamo M, Leivo T, Saarialho-Kere U. Differential expression of tissue inhibitors of metalloproteinases (TIMP-1, -2, -3, and -4) in normal and aberrant wound healing. Human Pathology 1999; 30:795-802.
[8]        Hosokawa R, Nonaka K, Morifuji M, Shum L, Ohishi M. TGF-beta 3 decreases type I collagen and scarring after labioplasty. Journal of dental research 2003; 82(7):558-64.
[9]        Lawrence WT, Diegelmann RF. Growth factors in wound healing. Clinics in Dermatology 1994; 12:157-169.
[10]       Kapoor M, Nomiyama T, Bruemmer D, Kojima F, Crofford LJ. Growth factors and cytokines: Emphasis on their role in wound healing and atherosclerosis. Current Anaesthesia & Critical Care 2006; 17:13-20.
[11]       Melendez-Zajgla J, Del Pozo L, Ceballos G, Maldonado V. Tissue inhibitor of metalloproteinases-4. The road less traveled. Mol Cancer. 2008; 7: 85.
[12]       Robinson LL,  Sznajder NA, Riley SC, Anderson R.A. Matrix metalloproteinases and tissue inhibitors of metalloproteinases in human fetal testis and ovary. Molecular human reproduction 2001; 7(7):641-648.
[13]       Chin JS, Madden L, Chew SY,  L.Becker D. Drug therapies and delivery mechanisms to treat perturbed skin wound healing. Advanced Drug Delivery Reviews 2019; corrected proof.
[14]       Li K, Tay FR, Yung Yui CK. The past, present and future perspectives of matrix metalloproteinase inhibitors. Pharmacology and Therapeutics 2019; available online.
[15]       Krishnaswamy VR, Mintz D, Sagi I. Matrix metalloproteinases: The sculptors of chronic cutaneous wounds. BBA - Molecular Cell Research 2017; 1864(11):2220-2227.
[16]       16.            Leco K.J, Apte SS, Taniguchi GT, Hawkes SP, Khokha R, Schultz GA, et al. Murine tissue inhibitor of metalloproteinases—4 (Timp—4): cDNA isolation and expression in adult mouse tissues. FEBS Letters 1997; 401(2-3).
[17]       Yazdan-Ashoori P, Liaw P, Toltl L, Webb B, Kilmer G, Carter D E, et al. Elevated plasma matrix metalloproteinases and their tissue inhibitors in patients with severe sepsis. Journal of Critical Care 2011; 26: 556–565.
[18]       Gomis-Rüth FX, Maskos K, Betz M, Bergner A, Huber R, Suzuki K, et al. BodeMechanism of inhibition of the human matrix metalloproteinase stromelysin-1 by TIMP-1.Nature 1997;389:77-81.
[19]       Wang M, Liu YE,  Greene J, Sheng S, Fuchs A, Rosen EM,
 
[20]       et al. Inhibition of tumor growth and metastasis of human breast cancer cells transfected with tissue inhibitor of metalloproteinase 4. Oncogene 1997; 14:2767-2774.
[21]       García-Gubern CF, Colon-Rolon L,  Bond MC. Essential Concepts of Wound Management. Emergency medicine clinics 2010; 28(4):951-967.
[22]       Couses LM, Fingleton B, Matrisian LM. Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Sciences 2002 ; 295:2387-2392.
[23]       Gill SE, Parks WC. Metalloproteinases and their inhibitors: Regulators of wound healing. The International Journal of Biochemistry & Cell Biology 2008; 40(6-7):1334-1347.
[24]       Manuel JA, Gawronska-Kozak B. Matrix metalloproteinase 9 (MMP-9) is upregulated during scarless wound healing in athymic nude mice. Matrix Biology 2006; 25(8):505-514.
[25]       Kyriakides TR, Wulsin D, Skokos EA, Fleckman P, Pirrone A, Shipley M, et al. Mice that lack matrix metalloproteinase-9 display delayed wound healing associated with delayed reepithelization and disordered collagen fibrillogenesis. Matrix Biology 2009; 28(2):56-73.
[26]       Krishnan N, Velramara B, Ramatchandirin B, Abraham GC, Duraisamy N, Pandiyan R, et al.  Effect of biogenic silver nanocubes on matrix metalloproteinases 2 and 9 expressions in hyperglycemic skin injury and its impact in early wound healing in streptozotocin-induced diabetic mice. 2018; 91:146-152.
[27]       Salo T , Mäkelä M , Kylmäniemi M , Autio-Harmainen H , Larjava H . Expression of matrix metalloproteinase-2 and -9 during early human wound healing. Journal of Technical Methods and Pathology 1994; 70(2):176-182.
[28]       Yeh F, Shen H, Tai H. Decreased production of MCP-1 and MMP-2 by keloid-derived fibroblasts. Burns 2009; 35(3):348-351.
[29]       Rohani MG, Parks WC. Matrix remodeling by MMPs during wound repair. Matrix biology 2015; 44-46:113-121.
[30]       Rhett J M, Ghatnekar GS, Palatinus J.A, O’Quinn M, Yost MJ, Gourdie RG. Novel therapies for scar reduction and regenerative healing of skin wounds. Trends in biotechnology 2008; 26:173-180.
[31]       Limaye AM, Desai KV, Chavalmane AK, Kondaiah P. Regulation of mRNAs encoding MMP-9 and MMP-2, and their inhibitors TIMP-1 and TIMP-2 by androgens in the rat ventral prostate. Molecular and cellular Endocrinology 2008; 294:10-18.
[32]       Tandara AA, Mustoe TA. MMP- and TIMP-secretion by human cutaneous keratinocytes and fibroblasts – impact of coculture and hydration. Journal of Plastic, Reconstructive & Aesthetic Surgery 2011 Jan; 64:108-116.
[33]       Tsirogianni AK, Moutsopoulos NM, Moutsopoulos HM. Wound healing: Immunological aspects. Injury 2006; 37:S5-S12.
[34]       Mohammed FF, Smookler DS, Khokha R. Metalloproteinases, inflammation, and rheumatoid arthritis. Annals of rheumatic diseases 2003; 62(2): 43-47.
[35]       Tsukamoto H, Yokoyama Y, Suzuki T, Mizuta S, Yoshinaka R. Expression of fugu TIMP-3 and -4 genes in adult tissues and embryos. Comparative Biochemistry and Physiology 2006; 144:395–403.